Peanut Marker Database

AHGS2220 Information

Marker name AHGS2220
Marker category Genome-SSR
Primer sequences Fw GAAAACCCATTCGAGGATGA
Rv CCAAACAATAAATGTCGAGGG
EST/Genome sequences KIAC11M09
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 40.294
BF6 Linkage BB10
Position 20.265
BF6 Linkage BB04
Position 24.302
Integrated consensus map Linkage B04
Position 70.426
Integrated consensus map Linkage B10
Position 60.195
SNP Position
Method
SSR Fragment size 224
Pattern* AC
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea