Peanut Marker Database

AHGS2215 Information

Marker name AHGS2215
Marker category Genome-SSR
Primer sequences Fw TGCACTCTGTGTGTGTGTGTG
Rv ATGGTTGTCCAGGTTGAAGC
EST/Genome sequences KIAC10D01
Lines
PIC Value
Lines
Map NYF2 Linkage LG01.1
Position 28.847
AF5 Linkage AA10
Position 23.029
AF5 Linkage AA01
Position 28.317
TF6 Linkage TA01
Position 51.558
Integrated consensus map Linkage A01
Position 90.758
Integrated consensus map Linkage A10
Position 93.66
SNP Position
Method
SSR Fragment size 263
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea