Peanut Marker Database

AHGS2207 Information

Marker name AHGS2207
Marker category Genome-SSR
Primer sequences Fw GGTTGCTCACCGGATAGAGA
Rv CTCGCGCTTCATTTCCTTAC
EST/Genome sequences SACT14P23
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 49.616
BF6 Linkage BB06
Position 0.0
Integrated consensus map Linkage B06
Position 69.197
Integrated consensus map Linkage B05
Position 57.798
SNP Position
Method
SSR Fragment size 298
Pattern* AC
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea