Peanut Marker Database

AHGS2206 Information

Marker name AHGS2206
Marker category Genome-SSR
Primer sequences Fw CCATATCATAGCCGCCAAGT
Rv TACATCCACGATGCAGAAGG
EST/Genome sequences SACT14D14
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 24.92
BF6 Linkage BB10
Position 23.341
Integrated consensus map Linkage B10
Position 63.792
Integrated consensus map Linkage A01
Position 82.737
SNP Position
Method
SSR Fragment size 273
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea