Peanut Marker Database

AHGS2205 Information

Marker name AHGS2205
Marker category Genome-SSR
Primer sequences Fw CAACCACCACTTCACCCTTT
Rv CTGCTTGAATGCAAAATTGG
EST/Genome sequences SACT14B15
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.1
Position 0.0
BF6 Linkage BB09
Position 32.549
TF6 Linkage TA09
Position 45.051
TF6 Linkage TB09
Position 42.226
Integrated consensus map Linkage B09
Position 93.736
Integrated consensus map Linkage A09
Position 68.659
SNP Position
Method
SSR Fragment size 188
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea