Peanut Marker Database

AHGS2195 Information

Marker name AHGS2195
Marker category Genome-SSR
Primer sequences Fw CAGCAGCAGGAGTAGGCTTC
Rv CAAAACCCTGCCTTGAAAAA
EST/Genome sequences SACT11I12
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 43.779
AF5 Linkage AA09
Position 13.984
AF5 Linkage AA06
Position 31.806
TF6 Linkage TB06
Position 47.474
Integrated consensus map Linkage A06
Position 59.134
Integrated consensus map Linkage A09
Position 80.403
Integrated consensus map Linkage B05
Position 50.073
Integrated consensus map Linkage B06
Position 43.736
SNP Position
Method
SSR Fragment size 216
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea