Peanut Marker Database

AHGS2193 Information

Marker name AHGS2193
Marker category Genome-SSR
Primer sequences Fw GGATGCTGTAAATGAGAAAATGG
Rv TGTGTTTCAAATGGGGTTCC
EST/Genome sequences SACT09B21
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 64.146
TF6 Linkage TB04
Position 13.131
TF6 Linkage TA04
Position 56.516
Integrated consensus map Linkage A04
Position 49.906
Integrated consensus map Linkage B04
Position 64.239
SNP Position
Method
SSR Fragment size 201
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea