Peanut Marker Database

AHGS2188 Information

Marker name AHGS2188
Marker category Genome-SSR
Primer sequences Fw AGCACACGAACACACACACA
Rv CTCTCTCTCTCTCCCCAGCC
EST/Genome sequences SACT06P07
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.1
Position 102.348
AF5 Linkage AA01
Position 21.195
AF5 Linkage AA07
Position 13.594
AF5 Linkage AA01
Position 20.867
BF6 Linkage BB03
Position 21.074
BF6 Linkage BB08
Position 0.0
Integrated consensus map Linkage A08
Position 54.913
Integrated consensus map Linkage B03
Position 58.266
Integrated consensus map Linkage B08
Position 90.842
Integrated consensus map Linkage A01
Position 78.388
Integrated consensus map Linkage A01
Position 78.639
Integrated consensus map Linkage A07
Position 72.162
SNP Position
Method
SSR Fragment size 183
Pattern* AG
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea