Marker name | AHGS2186 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CGATAGGCCGCTACTGAAAG | |
Rv | GGATTAGGGTTTCCAACGGT | ||
EST/Genome sequences | SACT06K21 | ||
Lines | |||
PIC | Value | ||
Lines | |||
Map | SKF2 | Linkage | LG03.1 |
Position | 86.614 | ||
TF6 | Linkage | TB03 | |
Position | 52.911 | ||
Integrated consensus map | Linkage | B03 | |
Position | 38.157 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 290 | |
Pattern* | AG | ||
Repeat count | 15 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.