Peanut Marker Database

AHGS2167 Information

Marker name AHGS2167
Marker category Genome-SSR
Primer sequences Fw AGAGCACGGCGTAGTAAGGA
Rv CGCTAATCCCCGAAGTTCAT
EST/Genome sequences SAAC08B11
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.1
Position 18.61
AF5 Linkage AA06
Position 41.107
BF6 Linkage BB03
Position 26.732
TF6 Linkage TA01
Position 31.079
TF6 Linkage TA05
Position 22.862
TF6 Linkage TA10
Position 8.91
Integrated consensus map Linkage A10
Position 96.549
Integrated consensus map Linkage B03
Position 62.702
Integrated consensus map Linkage A01
Position 62.722
Integrated consensus map Linkage A05
Position 50.96
Integrated consensus map Linkage A06
Position 68.414
SNP Position
Method
SSR Fragment size 280
Pattern* AC
Repeat count 15
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea