Peanut Marker Database

AHGS2153 Information

Marker name AHGS2153
Marker category Genome-SSR
Primer sequences Fw AAAAGGCACCTGGAAAAGGT
Rv CGCCATTTCTTGAGTTTGGT
EST/Genome sequences KICT13P23
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.1
Position 100.503
NYF2 Linkage LG07.1
Position 99.264
BF6 Linkage BB08
Position 19.682
TF6 Linkage TA07
Position 37.999
Integrated consensus map Linkage B08
Position 63.42
Integrated consensus map Linkage A07
Position 77.131
SNP Position
Method
SSR Fragment size 295
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea