Peanut Marker Database

AHGS2149 Information

Marker name AHGS2149
Marker category Genome-SSR
Primer sequences Fw CCCCACGTTAATTACAACCG
Rv TACAGCCTCATTGGGAAAGG
EST/Genome sequences KICT11H04
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 7.961
BF6 Linkage BB06
Position 12.157
TF6 Linkage TA06
Position 35.314
TF6 Linkage TB06
Position 15.305
Integrated consensus map Linkage B06
Position 79.285
Integrated consensus map Linkage A06
Position 35.535
SNP Position
Method
SSR Fragment size 293
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea