Peanut Marker Database

AHGS2148 Information

Marker name AHGS2148
Marker category Genome-SSR
Primer sequences Fw TCCCATTGAGACTGAGCCTT
Rv GGTTCAAGCCTAGGGTCCTT
EST/Genome sequences KICT09F09
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 56.471
BF6 Linkage BB01
Position 12.256
TF6 Linkage TB01
Position 32.515
TF6 Linkage TA01
Position 56.285
Integrated consensus map Linkage A01
Position 95.506
Integrated consensus map Linkage B01
Position 43.712
SNP Position
Method
SSR Fragment size 241
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea