Peanut Marker Database

AHGS2145 Information

Marker name AHGS2145
Marker category Genome-SSR
Primer sequences Fw CTTTTGATCAACGGGTTCGT
Rv AACCCTAACCACGCTTCCAT
EST/Genome sequences KICT10O20
Lines
PIC Value
Lines
Map AF5 Linkage AA10
Position 25.514
TF6 Linkage TB06
Position 16.608
Integrated consensus map Linkage B06
Position 80.458
Integrated consensus map Linkage A10
Position 90.328
SNP Position
Method
SSR Fragment size 230
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea