Peanut Marker Database

AHGS2139 Information

Marker name AHGS2139
Marker category Genome-SSR
Primer sequences Fw CGAATGCTAGTATGGTTTGCC
Rv TGCACACAGGGTATGACCTC
EST/Genome sequences KICT08N08
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.2
Position 78.569
BF6 Linkage BB03
Position 15.972
BF6 Linkage BB06
Position 16.568
BF6 Linkage BB07
Position 36.008
TF6 Linkage TA03
Position 33.74
TF6 Linkage TA06
Position 24.195
TF6 Linkage TB06
Position 12.609
Integrated consensus map Linkage B07
Position 90.422
Integrated consensus map Linkage A03
Position 68.609
Integrated consensus map Linkage A06
Position 24.39
Integrated consensus map Linkage B03
Position 51.737
Integrated consensus map Linkage B06
Position 81.846
SNP Position
Method
SSR Fragment size 286
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea