Peanut Marker Database

AHGS2132 Information

Marker name AHGS2132
Marker category Genome-SSR
Primer sequences Fw TGAACCCTCGGATGAGAAGT
Rv AGTCCCGAGAAGCAGCATAA
EST/Genome sequences KICT05N24
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 36.591
BF6 Linkage BB04
Position 21.791
TF6 Linkage TA04
Position 57.13
TF6 Linkage TB04
Position 17.604
Integrated consensus map Linkage B04
Position 63.763
Integrated consensus map Linkage A04
Position 51.206
SNP Position
Method
SSR Fragment size 131
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea