Peanut Marker Database

AHGS2131 Information

Marker name AHGS2131
Marker category Genome-SSR
Primer sequences Fw GGCATAGTGAACGCCATTTT
Rv AAGTCCCTCCTCTTCTCCCA
EST/Genome sequences KICT05N08
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 82.589
AF5 Linkage AA08
Position 6.16
AF5 Linkage AA01
Position 27.158
TF6 Linkage TB07
Position 29.343
Integrated consensus map Linkage A01
Position 84.886
Integrated consensus map Linkage A08
Position 19.899
Integrated consensus map Linkage B07
Position 86.16
SNP Position
Method
SSR Fragment size 294
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea