Peanut Marker Database

AHGS2127 Information

Marker name AHGS2127
Marker category Genome-SSR
Primer sequences Fw CTAAACCATACCTTGGGCGA
Rv TTTGGTCCGTGCATACGTTA
EST/Genome sequences KIAC13B22
Lines
PIC Value
Lines
Map SKF2 Linkage LG09.2
Position 38.724
AF5 Linkage AA09
Position 13.866
BF6 Linkage BB02
Position 13.309
TF6 Linkage TA09
Position 35.156
Integrated consensus map Linkage B02
Position 62.385
Integrated consensus map Linkage A09
Position 80.035
SNP Position
Method
SSR Fragment size 249
Pattern* AT
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea