Peanut Marker Database

AHGS2108 Information

Marker name AHGS2108
Marker category Genome-SSR
Primer sequences Fw TGACCTTCTACCCATGAGTTTG
Rv CCCAGTCAAAATTTTCAACAA
EST/Genome sequences SACT14M21
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.2
Position 82.963
AF5 Linkage AA04
Position 45.509
BF6 Linkage BB04
Position 35.793
TF6 Linkage TA04
Position 66.579
TF6 Linkage TB04
Position 24.492
Integrated consensus map Linkage A04
Position 59.839
Integrated consensus map Linkage B04
Position 80.185
SNP Position
Method
SSR Fragment size 298
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea