Peanut Marker Database

AHGS2106 Information

Marker name AHGS2106
Marker category Genome-SSR
Primer sequences Fw CGTTAACAACACCAACGTGC
Rv TGTTCTCCCCATTTCCTCAC
EST/Genome sequences SACT12P18
Lines
PIC Value
Lines
Map BF6 Linkage BB06
Position 17.456
TF6 Linkage TA06
Position 56.846
Integrated consensus map Linkage B06
Position 86.016
Integrated consensus map Linkage A06
Position 61.143
SNP Position
Method
SSR Fragment size 264
Pattern* AG
Repeat count 16
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea