Peanut Marker Database

AHGS2061 Information

Marker name AHGS2061
Marker category Genome-SSR
Primer sequences Fw GGAAACCCTAACAGCGATGA
Rv GATACGAAGCAAACGCCATT
EST/Genome sequences KICT13H13
Lines
PIC Value
Lines
Map BF6 Linkage BB09
Position 30.603
TF6 Linkage TA09
Position 44.894
Integrated consensus map Linkage B09
Position 87.712
Integrated consensus map Linkage A09
Position 69.088
SNP Position
Method
SSR Fragment size 139
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea