Peanut Marker Database

AHGS2058 Information

Marker name AHGS2058
Marker category Genome-SSR
Primer sequences Fw GGAACACCTGAGCCATGAAT
Rv TGCAGCATGGATTCAGAAAA
EST/Genome sequences KICT12I02
Lines
PIC Value
Lines
Map SKF2 Linkage LG10.1
Position 79.933
TF6 Linkage TB06
Position 25.098
TF6 Linkage TA03
Position 0.0
Integrated consensus map Linkage A03
Position 36.507
Integrated consensus map Linkage B06
Position 73.545
SNP Position
Method
SSR Fragment size 266
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea