Peanut Marker Database

AHGS2051 Information

Marker name AHGS2051
Marker category Genome-SSR
Primer sequences Fw TTTTGTGGGAAATGGGGTTA
Rv TCACGAACCTCACCAGATCA
EST/Genome sequences KICT10I07
Lines
PIC Value
Lines
Map TF6 Linkage TA07
Position 38.984
TF6 Linkage TB05
Position 47.366
Integrated consensus map Linkage B05
Position 79.306
Integrated consensus map Linkage A07
Position 75.161
SNP Position
Method
SSR Fragment size 282
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea