Peanut Marker Database

AHGS2048 Information

Marker name AHGS2048
Marker category Genome-SSR
Primer sequences Fw GTCTCTTGAGGTCCTGTCGG
Rv GGTTCTTCCTCCATGAGCAG
EST/Genome sequences KICT07G01
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 11.232
BF6 Linkage BB04
Position 25.474
TF6 Linkage TB04
Position 11.869
TF6 Linkage TB10
Position 19.109
TF6 Linkage TA04
Position 56.666
Integrated consensus map Linkage A04
Position 49.593
Integrated consensus map Linkage B04
Position 69.11
Integrated consensus map Linkage B10
Position 51.055
SNP Position
Method
SSR Fragment size 268
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea