Peanut Marker Database

AHGS2019 Information

Marker name AHGS2019
Marker category Genome-SSR
Primer sequences Fw ACCCACAAAAGGAACACAGG
Rv GAGGAGAACACAGTCATACAGAGAA
EST/Genome sequences SACT14F13
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.1
Position 51.25
NYF2 Linkage LG01.1
Position 11.399
BF6 Linkage BB01
Position 30.866
TF6 Linkage TB07
Position 29.304
TF6 Linkage TB07
Position 29.383
TF6 Linkage TA01
Position 49.232
TF6 Linkage TB05
Position 21.347
Integrated consensus map Linkage A01
Position 84.592
Integrated consensus map Linkage B01
Position 60.681
Integrated consensus map Linkage B05
Position 40.381
Integrated consensus map Linkage B07
Position 85.792
Integrated consensus map Linkage B07
Position 85.818
SNP Position
Method
SSR Fragment size 270
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea