Peanut Marker Database

AHGS2013 Information

Marker name AHGS2013
Marker category Genome-SSR
Primer sequences Fw CCATCCTCAAGCTTCTTCCT
Rv GACGACAGAACACCAAAGCA
EST/Genome sequences SACT11H18
Lines
PIC Value
Lines
Map TF6 Linkage TA03
Position 27.985
TF6 Linkage TB03
Position 56.406
Integrated consensus map Linkage B03
Position 46.912
Integrated consensus map Linkage A03
Position 67.042
SNP Position
Method
SSR Fragment size 96
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea