Peanut Marker Database

AHGS1991 Information

Marker name AHGS1991
Marker category Genome-SSR
Primer sequences Fw ATGGCCAGGTAAGAAGAGGC
Rv TGCAAACCAACAACATCAGA
EST/Genome sequences SACT05F04
Lines
PIC Value
Lines
Map SKF2 Linkage LG01.1
Position 30.235
TF6 Linkage TA04
Position 56.42
TF6 Linkage TA01
Position 4.426
Integrated consensus map Linkage A01
Position 31.566
Integrated consensus map Linkage A04
Position 50.014
SNP Position
Method
SSR Fragment size 226
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea