Peanut Marker Database

AHGS1980 Information

Marker name AHGS1980
Marker category Genome-SSR
Primer sequences Fw TTTCCATCGGATTTTTCGTC
Rv GAGGTGGCAACGGTGATAGT
EST/Genome sequences SAAC11M13
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.1
Position 92.164
NYF2 Linkage LG07.1
Position 97.489
BF6 Linkage BB07
Position 34.569
BF6 Linkage BB08
Position 19.077
BF6 Linkage BB05
Position 16.318
TF6 Linkage TA07
Position 33.147
Integrated consensus map Linkage A07
Position 73.105
Integrated consensus map Linkage B05
Position 48.746
Integrated consensus map Linkage B07
Position 89.567
Integrated consensus map Linkage B08
Position 60.609
SNP Position
Method
SSR Fragment size 230
Pattern* AG
Repeat count 17
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea