| Marker name | AHGS1969 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | CCACTGTTTCGTTCCCTCAT | |
| Rv | GATTCAAACGAAACCGCATT | ||
| EST/Genome sequences | KICT14B09 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | SKF2 | Linkage | LG09.1 |
| Position | 84.228 | ||
| NYF2 | Linkage | LG09.1 | |
| Position | 0.0 | ||
| TF6 | Linkage | TB09 | |
| Position | 1.61 | ||
| Integrated consensus map | Linkage | B09 | |
| Position | 46.694 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 242 | |
| Pattern* | AG | ||
| Repeat count | 18 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.