Peanut Marker Database

AHGS1961 Information

Marker name AHGS1961
Marker category Genome-SSR
Primer sequences Fw CCTCTCCCTACACCCTCTCC
Rv AGGGTTTCGTTGAGGAGGTT
EST/Genome sequences KICT10M22
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 44.793
AF5 Linkage AA10
Position 36.844
Integrated consensus map Linkage B10
Position 80.523
Integrated consensus map Linkage A10
Position 79.625
SNP Position
Method
SSR Fragment size 173
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea