Peanut Marker Database

AHGS1948 Information

Marker name AHGS1948
Marker category Genome-SSR
Primer sequences Fw CAGGAAGGAATGGTGGAGAA
Rv AAAAGTCCGCCAAATCGAG
EST/Genome sequences KICT06N14
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.2
Position 38.522
NYF2 Linkage LG06.2
Position 73.827
NYF2 Linkage LGX
Position 0.0
BF6 Linkage BB06
Position 16.09
TF6 Linkage TA06
Position 16.877
Integrated consensus map Linkage B06
Position 80.766
Integrated consensus map Linkage A06
Position 16.896
SNP Position
Method
SSR Fragment size 271
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea