Peanut Marker Database

AHGS1947 Information

Marker name AHGS1947
Marker category Genome-SSR
Primer sequences Fw ATCTTGGATCTTGGTGACGG
Rv TTACCCTTTTCACACCACCC
EST/Genome sequences KICT06O16
Lines
PIC Value
Lines
Map SKF2 Linkage LG08.1
Position 25.621
TF6 Linkage TA08
Position 9.072
TF6 Linkage TA02
Position 57.135
Integrated consensus map Linkage A02
Position 49.048
Integrated consensus map Linkage A08
Position 9.578
SNP Position
Method
SSR Fragment size 209
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea