Peanut Marker Database

AHGS1946 Information

Marker name AHGS1946
Marker category Genome-SSR
Primer sequences Fw CGCGTGTATATTGCTGAAGTG
Rv CAAGTCTCGATGAACCACCC
EST/Genome sequences KICT09D02
Lines
PIC Value
Lines
Map SKF2 Linkage LG05.2
Position 74.525
BF6 Linkage BB05
Position 16.986
BF6 Linkage BB01
Position 24.86
TF6 Linkage TB05
Position 0.0
Integrated consensus map Linkage B01
Position 55.954
Integrated consensus map Linkage B05
Position 33.021
SNP Position
Method
SSR Fragment size 171
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea