Peanut Marker Database

AHGS1943 Information

Marker name AHGS1943
Marker category Genome-SSR
Primer sequences Fw ATTCATTCTCTAACCGCCGA
Rv GATAGCATTTTCGTTGACCG
EST/Genome sequences KICT06G02
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.2
Position 82.478
NYF2 Linkage LG06.2
Position 84.587
TF6 Linkage TB06
Position 32.348
TF6 Linkage TB06
Position 31.02
Integrated consensus map Linkage B06
Position 92.21
Integrated consensus map Linkage B06
Position 97.804
Integrated consensus map Linkage B06
Position 98.592
SNP Position
Method
SSR Fragment size 189
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea