Peanut Marker Database

AHGS1941 Information

Marker name AHGS1941
Marker category Genome-SSR
Primer sequences Fw TTCAGCTTCTCTCTGTGGCA
Rv CCTTCTCCCTCCCTCTCATC
EST/Genome sequences KICT05A07
Lines
PIC Value
Lines
Map AF5 Linkage AA04
Position 46.17
AF5 Linkage AA09
Position 12.303
Integrated consensus map Linkage A09
Position 83.249
Integrated consensus map Linkage A04
Position 41.529
SNP Position
Method
SSR Fragment size 295
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea