Peanut Marker Database

AHGS1937 Information

Marker name AHGS1937
Marker category Genome-SSR
Primer sequences Fw GGATAGAGCAAAGCAGTGGC
Rv CCGATTTCAGAGTCCCCATA
EST/Genome sequences KICT05A21
Lines
PIC Value
Lines
Map SKF2 Linkage LG04.1
Position 61.996
AF5 Linkage AA04
Position 43.44
AF5 Linkage AA04
Position 36.308
BF6 Linkage BB04
Position 25.008
TF6 Linkage TB04
Position 13.711
Integrated consensus map Linkage A04
Position 51.503
Integrated consensus map Linkage A04
Position 52.376
Integrated consensus map Linkage B04
Position 65.547
SNP Position
Method
SSR Fragment size 289
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea