Peanut Marker Database

AHGS1930 Information

Marker name AHGS1930
Marker category Genome-SSR
Primer sequences Fw AACATCTGCCAAATGCAACA
Rv CTGCCATGTGTGCTTGAACT
EST/Genome sequences KIAC06M09
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.1
Position 66.852
SKF2 Linkage LG06.2
Position 53.104
NYF2 Linkage LG02.1
Position 43.688
NYF2 Linkage LG06.2
Position 76.224
TF6 Linkage TA10
Position 8.188
TF6 Linkage TB02
Position 26.007
TF6 Linkage TB06
Position 16.23
Integrated consensus map Linkage B02
Position 68.804
Integrated consensus map Linkage B06
Position 79.714
Integrated consensus map Linkage A10
Position 92.878
SNP Position
Method
SSR Fragment size 295
Pattern* AC
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea