Peanut Marker Database

AHGS1915 Information

Marker name AHGS1915
Marker category Genome-SSR
Primer sequences Fw TTTGGAAACCAAACGAAACC
Rv ACACATCCAAAAGTTGCACA
EST/Genome sequences SACT12G04
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 85.256
BF6 Linkage BB07
Position 35.536
TF6 Linkage TB07
Position 30.389
TF6 Linkage TA07
Position 42.866
Integrated consensus map Linkage A07
Position 80.963
Integrated consensus map Linkage B07
Position 89.185
SNP Position
Method
SSR Fragment size 199
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea