Peanut Marker Database

AHGS1905 Information

Marker name AHGS1905
Marker category Genome-SSR
Primer sequences Fw ACTTCTCTTCTCCCCACCGT
Rv CATGGCTCAGCCTTTCTTTC
EST/Genome sequences SACT09G19
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 32.341
AF5 Linkage AA10
Position 26.129
AF5 Linkage AA05
Position 50.901
BF6 Linkage BB10
Position 9.251
TF6 Linkage TA01
Position 41.601
TF6 Linkage TB09
Position 19.089
Integrated consensus map Linkage B09
Position 70.746
Integrated consensus map Linkage B10
Position 72.227
Integrated consensus map Linkage A01
Position 86.398
Integrated consensus map Linkage A05
Position 53.156
Integrated consensus map Linkage A10
Position 89.533
SNP Position
Method
SSR Fragment size 112
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea