Peanut Marker Database

AHGS1904 Information

Marker name AHGS1904
Marker category Genome-SSR
Primer sequences Fw TCTTCCGAATCAAAATTGGC
Rv TTCCTTCCTCATATCTGCCG
EST/Genome sequences SACT08I02
Lines
PIC Value
Lines
Map SKF2 Linkage LG03.1
Position 72.937
TF6 Linkage TB03
Position 74.936
TF6 Linkage TB08
Position 26.732
TF6 Linkage TA05
Position 23.809
Integrated consensus map Linkage A05
Position 49.892
Integrated consensus map Linkage B03
Position 63.728
Integrated consensus map Linkage B08
Position 64.656
SNP Position
Method
SSR Fragment size 233
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea