Peanut Marker Database

AHGS1903 Information

Marker name AHGS1903
Marker category Genome-SSR
Primer sequences Fw CCAGGTTCACACATTCATCC
Rv TCTGTGAGCTTGCCTCAATG
EST/Genome sequences SACT07O08
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 53.731
TF6 Linkage TA09
Position 35.156
Integrated consensus map Linkage B10
Position 89.069
Integrated consensus map Linkage A09
Position 80.19
SNP Position
Method
SSR Fragment size 127
Pattern* AG
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea