Peanut Marker Database

AHGS1882 Information

Marker name AHGS1882
Marker category Genome-SSR
Primer sequences Fw ATAGTCCCGCTCACGAATTG
Rv TAGTGCCGACCACACTCTTG
EST/Genome sequences SAAC14I01
Lines
PIC Value
Lines
Map TF6 Linkage TA10
Position 8.207
TF6 Linkage TA06
Position 33.155
Integrated consensus map Linkage A06
Position 33.111
Integrated consensus map Linkage A10
Position 92.848
SNP Position
Method
SSR Fragment size 266
Pattern* AC
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea