Peanut Marker Database

AHGS1879 Information

Marker name AHGS1879
Marker category Genome-SSR
Primer sequences Fw CCCAACAACATATGCAGCAA
Rv CACACACGCACAAGTTCACA
EST/Genome sequences SAAC14P17
Lines
PIC Value
Lines
Map AF5 Linkage AA06
Position 33.593
TF6 Linkage TB08
Position 27.894
TF6 Linkage TA06
Position 58.312
Integrated consensus map Linkage A06
Position 59.831
Integrated consensus map Linkage B08
Position 63.469
SNP Position
Method
SSR Fragment size 99
Pattern* AC
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea