Peanut Marker Database

AHGS1875 Information

Marker name AHGS1875
Marker category Genome-SSR
Primer sequences Fw TCTCACACAAAATGTCAAGGAT
Rv TCTAGTCGGCCTTGTCTTCG
EST/Genome sequences SAAC08J08
Lines
PIC Value
Lines
Map SKF2 Linkage LG07.2
Position 87.669
BF6 Linkage BB10
Position 19.953
TF6 Linkage TB07
Position 29.304
TF6 Linkage TA10
Position 4.643
Integrated consensus map Linkage A10
Position 89.87
Integrated consensus map Linkage B07
Position 86.778
Integrated consensus map Linkage B10
Position 60.874
SNP Position
Method
SSR Fragment size 169
Pattern* AC
Repeat count 18
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea