Peanut Marker Database

AHGS1853 Information

Marker name AHGS1853
Marker category Genome-SSR
Primer sequences Fw TTTTAGATCCATTTGGTTTCTCTTT
Rv GGACCAAAAATCTCTGAGCG
EST/Genome sequences KICT10B15
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.1
Position 83.025
NYF2 Linkage LG02.1
Position 32.09
AF5 Linkage AA03
Position 31.294
BF6 Linkage BB02
Position 20.869
Integrated consensus map Linkage B02
Position 56.686
Integrated consensus map Linkage A03
Position 91.843
SNP Position
Method
SSR Fragment size 250
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea