Peanut Marker Database

AHGS1838 Information

Marker name AHGS1838
Marker category Genome-SSR
Primer sequences Fw CCATAAGGTGGGTTGGTTGT
Rv GCATGAGACTCACCCTGGAG
EST/Genome sequences KICT06F02
Lines
PIC Value
Lines
Map BF6 Linkage BB03
Position 3.143
TF6 Linkage TB03
Position 41.167
TF6 Linkage TA03
Position 17.85
Integrated consensus map Linkage A03
Position 56.941
Integrated consensus map Linkage B03
Position 38.861
SNP Position
Method
SSR Fragment size 279
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea