Peanut Marker Database

AHGS1835 Information

Marker name AHGS1835
Marker category Genome-SSR
Primer sequences Fw GCATTTTAGTGACCCGCAAT
Rv TGGGAGAGGGGCTATGAT
EST/Genome sequences KICT05H21
Lines
PIC Value
Lines
Map SKF2 Linkage LG02.2
Position 7.095
BF6 Linkage BB07
Position 39.151
Integrated consensus map Linkage B10
Position 94.952
Integrated consensus map Linkage B07
Position 84.945
SNP Position
Method
SSR Fragment size 206
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea