| Marker name | AHGS1834 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GGAGAGTGAAGAATGCGGAG | |
| Rv | GAATCCGATCCTAAGTGGCA | ||
| EST/Genome sequences | KICT05A01 | ||
| Lines | |||
| PIC | Value | ||
| Lines | |||
| Map | AF5 | Linkage | AA01 |
| Position | 17.212 | ||
| AF5 | Linkage | AA04 | |
| Position | 45.763 | ||
| TF6 | Linkage | TA01 | |
| Position | 60.264 | ||
| TF6 | Linkage | TA04 | |
| Position | 69.492 | ||
| TF6 | Linkage | TA04 | |
| Position | 69.772 | ||
| TF6 | Linkage | TA09 | |
| Position | 23.922 | ||
| Integrated consensus map | Linkage | A01 | |
| Position | 72.321 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 57.115 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 62.122 | ||
| Integrated consensus map | Linkage | A04 | |
| Position | 62.784 | ||
| Integrated consensus map | Linkage | A09 | |
| Position | 90.745 | ||
| SNP | Position | ||
| Method | |||
| SSR | Fragment size | 141 | |
| Pattern* | AG | ||
| Repeat count | 19 | ||
| Method | PCR | ||
| Detection | |||
| Multiplex | |||
| Gel image | |||
| Enzyme | |||
| Related markers | Marker name | ||
| Species | |||
| Comments | Shirasawa et al. (2012) | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.