Peanut Marker Database

AHGS1834 Information

Marker name AHGS1834
Marker category Genome-SSR
Primer sequences Fw GGAGAGTGAAGAATGCGGAG
Rv GAATCCGATCCTAAGTGGCA
EST/Genome sequences KICT05A01
Lines
PIC Value
Lines
Map AF5 Linkage AA01
Position 17.212
AF5 Linkage AA04
Position 45.763
TF6 Linkage TA04
Position 69.492
TF6 Linkage TA04
Position 69.772
TF6 Linkage TA09
Position 23.922
TF6 Linkage TA01
Position 60.264
Integrated consensus map Linkage A04
Position 62.784
Integrated consensus map Linkage A09
Position 90.745
Integrated consensus map Linkage A01
Position 72.321
Integrated consensus map Linkage A04
Position 57.115
Integrated consensus map Linkage A04
Position 62.122
SNP Position
Method
SSR Fragment size 141
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea