Peanut Marker Database

AHGS1817 Information

Marker name AHGS1817
Marker category Genome-SSR
Primer sequences Fw CGGATTTACCGACGGACTAA
Rv GTGGTCTTTCCAACAGCGAT
EST/Genome sequences SACT14F17
Lines
PIC Value
Lines
Map SKF2 Linkage LG06.1
Position 37.597
AF5 Linkage AA10
Position 25.648
AF5 Linkage AA07
Position 7.166
TF6 Linkage TA10
Position 8.178
Integrated consensus map Linkage A07
Position 66.758
Integrated consensus map Linkage A10
Position 90.159
SNP Position
Method
SSR Fragment size 260
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea