Peanut Marker Database

AHGS1796 Information

Marker name AHGS1796
Marker category Genome-SSR
Primer sequences Fw TCCATTCCATGTGCACCTTA
Rv GGAAACTCCCCAATCACAGA
EST/Genome sequences SACT05N04
Lines
PIC Value
Lines
Map AF5 Linkage AA08
Position 8.816
BF6 Linkage BB07
Position 36.2
TF6 Linkage TB07
Position 33.484
TF6 Linkage TA08
Position 18.253
Integrated consensus map Linkage A08
Position 26.176
Integrated consensus map Linkage B07
Position 89.749
SNP Position
Method
SSR Fragment size 166
Pattern* AG
Repeat count 19
Method PCR
Detection
Multiplex
Gel image
Enzyme
Related markers Marker name
Species
Comments
Shirasawa et al. (2012)

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Arachis hypogaea